Reputation: 1442
I have the following FASTA file:
>header1
CGCTCTCTCCATCTCTCTACCCTCTCCCTCTCTCTCGGATAGCTAGCTCTTCTTCCTCCT
TCCTCCGTTTGGATCAGACGAGAGGGTATGTAGTGGTGCACCACGAGTTGGTGAAGC
>header2
GGT
>header3
TTATGAT
My desired output:
>header1
117
>header2
3
>header3
7
# 3 sequences, total length 127.
This is my code:
awk '/^>/ {print; next; } { seqlen = length($0); print seqlen}' file.fa
The output I get with this code is:
>header1
60
57
>header2
3
>header3
7
I need a small modification in order to deal with multiple sequence lines.
I also need a way to have the total sequences and total length. Any suggestion will be welcome... In bash or awk, please. I know that is easy to do it in Perl/BioPerl and actually, I have a script to do it in those ways.
Upvotes: 16
Views: 29581
Reputation: 26481
A quick way with any awk, would be this:
awk '/^>/{if (l!="") print l; print; l=0; next}{l+=length($0)}END{print l}' file.fasta
You might be also interested in BioAwk, it is an adapted version of awk which is tuned to process FASTA files
bioawk -c fastx '{print ">" $name ORS length($seq)}' file.fasta
Note: BioAwk is based on Brian Kernighan's awk which is documented in "The AWK Programming Language", by Al Aho, Brian Kernighan, and Peter Weinberger (Addison-Wesley, 1988, ISBN 0-201-07981-X) . I'm not sure if this version is compatible with POSIX.
Upvotes: 1
Reputation: 14955
An awk
/ gawk
solution can be composed by three stages:
Every time header
is found these actions should be performed:
sequence
lines we just need to accumulate totals.END
stage we print the remnant seqlen.Commented code:
awk '/^>/ { # header pattern detected
if (seqlen){
# print previous seqlen if exists
print seqlen
}
# pring the tag
print
# initialize sequence
seqlen = 0
# skip further processing
next
}
# accumulate sequence length
{
seqlen += length($0)
}
# remnant seqlen if exists
END{if(seqlen){print seqlen}}' file.fa
A oneliner:
awk '/^>/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen += length($0)}END{print seqlen}' file.fa
For the totals:
awk '/^>/ { if (seqlen) {
print seqlen
}
print
seqtotal+=seqlen
seqlen=0
seq+=1
next
}
{
seqlen += length($0)
}
END{print seqlen
print seq" sequences, total length " seqtotal+seqlen
}' file.fa
Upvotes: 24
Reputation: 621
I wanted to share some tweaks to klashxx's answer that might be useful. Its output differs in that it prints the sequence id and its length on one line, It's no longer a one-liner, so the downside is you'll have to save it as a script file.
It also parses out the sequence id from the header line, based on whitespace (chrM
in >chrM gi|251831106|ref|NC_012920.1|
). Then, you can select a specific sequence based on the id by setting the variable target
like so: $ awk -f seqlen.awk -v target=chrM seq.fa
.
BEGIN {
OFS = "\t"; # tab-delimited output
}
# Use substr instead of regex to match a starting ">"
substr($0, 1, 1) == ">" {
if (seqlen) {
# Only print info for this sequence if no target was given
# or its id matches the target.
if (! target || id == target) {
print id, seqlen;
}
}
# Get sequence id:
# 1. Split header on whitespace (fields[1] is now ">id")
split($0, fields);
# 2. Get portion of first field after the starting ">"
id = substr(fields[1], 2);
seqlen = 0;
next;
}
{
seqlen = seqlen + length($0);
}
END {
if (! target || id == target) {
print id, seqlen;
}
}
Upvotes: 1