Reputation: 614
I have two text files that have similar formatting. The first (732KB):
>lib_1749;size=599;
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTATTAAGTCAGCTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCTCACTAGACTGTCACTGACACTGATGCTCGAAAGTGTGGGTATCAAACA
--
>lib_2235;size=456;
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTATTAAGTCAGCTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCTTACTGGACTGTAACTGACGTTGAGGCTCGAAAGCGTGGGGAGCAAACA
--
>lib_13686;size=69;
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCAGGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGGCTGGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCTTGCTGGACTGTAACTGACACTGAGGCTCGAAAGCGTGGGGAGCAAACA
--
The second (5.26GB):
>Stool268_1 HWI-ST155_0605:1:1101:1194:2070#CTGTCTCTCCTA
TACGGAGGATGCGAGCGTTATCCGGATTTACTGGGTTTAAAGGGAGCGCAGACGGGACGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCCTAAAACTGCTAGCGGTGAAATGCTTAGATATCGGGAGGAACTCCGGTTGCGAAGGCAGCATACTGGACTGCAACTGACGCTGATGCTCGAAAGTGTGGGTATCAAACAGG
--
Note the key difference is the header for each entry (lib_1749 vs. Stool268_1). What I need is to create a mapping file between the headers of one file and the headers of the second using the sequence (e.g., TACGGAGGATGCGAGCGTTATCCGGAT...
) as a key.
Note as one final complication the mapping is not going to be 1-to-1 there will be multiple entries of the form Stool****** for each entry of lib****. This is because the length of the key in the first file was trimmed to have 200 characters but in the second file it can be longer.
For smaller files I would just do something like this in python but I often have trouble because these files are so big and cannot be read into memory at one time. Usually I try unix utilities but in this case I cannot think of how to accomplish this.
Thank you!
Upvotes: 2
Views: 264
Reputation: 22887
BioPython
should be able to read in large FASTA files.
from Bio import SeqIO
from collections import defaultdict
mapping = defaultdict(list)
for stool_record in SeqIO.parse('stool.fasta', 'fasta'):
stool_seq = str(stool_record.seq)
for lib_record in SeqIO.parse('libs.fasta', 'fasta'):
lib_seq = str(lib_record.seq)
if stool_seq.startswith(lib_seq):
mapping[lib_record.id.split(';')[0]].append(stool_record.id)
Upvotes: 0
Reputation: 2974
In my opinion, the easiest way would be to use BLAST+...
Set up the larger file as a BLAST database and use the smaller file as the query...
Then just write a small script to analyse the output - I.e. Take the top hit or two to create the mapping file.
BTW. You might find SequenceServer (Google it) helpful in setting up a custom Blast database and your BLAST environment...
Upvotes: 1