Reputation: 75
RNA_codon_dictonary = {
'UUU': 'F', 'CUU': 'L', 'AUU': 'I', 'GUU': 'V',
'UUC': 'F', 'CUC': 'L', 'AUC': 'I', 'GUC': 'V',
'UUA': 'L', 'CUA': 'L', 'AUA': 'I', 'GUA': 'V',
'UUG': 'L', 'CUG': 'L', 'AUG': 'M', 'GUG': 'V',
'UCU': 'S', 'CCU': 'P', 'ACU': 'T', 'GCU': 'A',
'UCC': 'S', 'CCC': 'P', 'ACC': 'T', 'GCC': 'A',
'UCA': 'S', 'CCA': 'P', 'ACA': 'T', 'GCA': 'A',
'UCG': 'S', 'CCG': 'P', 'ACG': 'T', 'GCG': 'A',
'UAU': 'Y', 'CAU': 'H', 'AAU': 'N', 'GAU': 'D',
'UAC': 'Y', 'CAC': 'H', 'AAC': 'N', 'GAC': 'D',
'UAA': 'Stop', 'CAA': 'Q', 'AAA': 'K', 'GAA': 'E',
'UAG': 'Stop', 'CAG': 'Q', 'AAG': 'K', 'GAG': 'E',
'UGU': 'C', 'CGU': 'R', 'AGU': 'S', 'GGU': 'G',
'UGC': 'C', 'CGC': 'R', 'AGC': 'S', 'GGC': 'G',
'UGA': 'Stop', 'CGA': 'R', 'AGA': 'R', 'GGA': 'G',
'UGG': 'W', 'CGG': 'R', 'AGG': 'R', 'GGG': 'G'
}
def RNA_to_Protien(mRNA_seq):
codon = []
if codon in RNA_codon_dictonary:
# return the aminoacid by looking up in the dictionary:
return RNA_codon_dictonary[codon]
else:
# return '' if we could not translate the codon:
return '?'
if __name__ == "__main__":
mRNA_seq = "UCAAUGUAACGCGCUACCCGGAGCUCUGGGCCCAAAUUUCAUCCACU"
print (RNA_to_Protien(mRNA_seq))
Upvotes: 0
Views: 1038
Reputation: 168876
You are checking to see if the empty list is a key in your dictionary. There are two problems with that:
1) The answer will always be no, since your dictionary doesn't have any empty keys, and
2) That operation isn't even allowed, since list
s are never allowed to be keys of a dict
.
Based on your comment, the following code might be what you are looking for. It breaks the sequence in non-overlapping substrings of length 3, looks up each substring in the dict
, and returns all of the results.
def RNA_to_Protien(mRNA_seq):
return [
RNA_codon_dictonary.get(mRNA_seq[i:i+3], '?')
for i in range(0, len(mRNA_seq), 3)
]
In your example sequence, this returns:
['S', 'M', 'Stop', 'R', 'A', 'T', 'R', 'S', 'S', 'G', 'P', 'K', 'F', 'H', 'P', '?']
Or, if you would rather lookup overlapping sequences, try this:
def RNA_to_Protien(mRNA_seq):
return [
RNA_codon_dictonary.get(mRNA_seq[i:i+3], '?')
for i in range(0, len(mRNA_seq)-2, 1)
]
It yields this result:
['S', 'Q', 'N', 'M', 'C', 'V', 'Stop', 'N', 'T', 'R', 'A', 'R', 'A', 'L', 'Y', 'T', 'P', 'P', 'R', 'G', 'E', 'S', 'A', 'L', 'S', 'L', 'W', 'G', 'G', 'A', 'P', 'P', 'Q', 'K', 'N', 'I', 'F', 'F', 'S', 'H', 'I', 'S', 'P', 'H', 'T']
And, based on your request to return a single string instead of a list of strings:
def RNA_to_Protien(mRNA_seq):
return ''.join(
RNA_codon_dictonary.get(mRNA_seq[i:i+3], '?')
for i in range(0, len(mRNA_seq), 3)
)
This yields:
'SMStopRATRSSGPKFHP?'
Upvotes: 1