CODEWITHSUNDEEP
python
doyoucalm
doyoucalm

Reputation: 3

transcribe mRNA code from DNA strand

I thought it would be easy to replace the string a into u and so on with this code

DNA= "atgcatgctagcagtcagcatcgatcgatcagctagctag"

   def transcribe(dna):

     dna.replace("a", "u")
     dna.replace("t", "a")
     dna.replace("g", "c")
     dna.replace("c", "g")
     return

it didn't change my variable at all. Can anybody help me to solve this?

Thank you

Upvotes: 0

Views: 116

Answers (1)

Amadan
Amadan

Reputation: 198566

  • dna.replace will yield the new string; it will not change dna. You would need to assign the result to something.
  • Replacing c with g and then g with c does not do what you think. E.g. atcg -> atgg -> atcc.
  • You do not return anything

The solution is to replace simultaneously:

import string
def transcribe(dna):
    return dna.translate(string.maketrans("atgc", "uacg"))

or to replace with an intermediary value:

def transcribe(dna):
    dna = dna.replace("a", "u")
    dna = dna.replace("t", "a")
    dna = dna.replace('g', '_')
    dna = dna.replace('c', 'g')
    dna = dna.replace('_', 'c')
    return dna

Upvotes: 2

Related Questions