CODEWITHSUNDEEP
pythonregexbioinformatics
austinkjensen
austinkjensen

Reputation: 1056

How to pass a parameter to a regular expression inside of a Python user-defined function?

Say I have a string of characters like:

'TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAACTCGATCGGTTGAACTCTATCACGCCTGGTCTTCGAAGTTAGCA'

And I would like to use a regular expression like re.findall to locate any instances of 3 entries (e.g. TTA or GTT for instance).

How can I pass the sub-string to a user-defined function such that this is possible?

What I tried was something like this:

def finder(sequence, codons):
    Y = re.findall(r'codons',sequence)
    return Y

However, when I attempt to call this function on my string that I gave above using some input for codons like 'TTA', all I get as a return is an empty list...

I think the list is empty because within the regular expression in my function, "codons" is within the quotation marks next to the r. Is there a way to pass something to a regular expression in a manner that circumvents this?

Upvotes: 2

Views: 2913

Answers (2)

Mahboob Alam
Mahboob Alam

Reputation: 21

A polished answer of your question (using python 3+):

# codon_search.py
import re

def finder(codon, fullseq):
    matched = re.findall(codon, fullseq)
    print (matched) 

sequence = "TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAAC"
search_str = "TTA"

#call function
finder(search_str, sequence)

Output: 3 matches will be found in the above sequence

['TTA', 'TTA', 'TTA']

Upvotes: 2

Ajax1234
Ajax1234

Reputation: 71451

You are trying to match the string "codons", rather than the variable parameter. Try this:

def finder(sequence, codons):
   return re.findall(codons, sequence)

Upvotes: 2

Related Questions