CODEWITHSUNDEEP
javastringcharsequencecounter
Yuki1112
Yuki1112

Reputation: 365

Sequence Count - Char in String java

I have the following assignment: Count how many "runs" of the given character appear in the given string. A "run" is a consecutive block of one or more occurrences of the same character. For example, if the string is "AATGGGGCCGGTTGGGGGGGGGAAGC" and the character is "G", returns 4. No import, '?' is allowed My attempt: 

public static int charRunCount(String str, char c){
    int counter = 0;
    for (int i = 0; i < str.length()-1; i++) {
        if ( (str.charAt (i) == str.charAt (i+1)) && str.charAt (i)==c )
            counter+=1;
    }
    return counter;
}

output =12, please help fix or correct.

Upvotes: 1

Views: 2038

Answers (1)

Peter Lawrey
Peter Lawrey

Reputation: 533590

You want to count the number of times a run of a particular character starts. The length of the run doesn't matter.

public static int charRunCount(String str, char c) {
    char last = 0;
    int counter = 0;
    for (int i = 0; i < str.length(); i++) {
        // whenever a run starts.
        if (last != c && str.charAt(i) == c)
            counter++;
        last = str.charAt(i);
    }
    return counter;
}

Upvotes: 5

Related Questions