Reputation: 211
I'm writing a short program in Python that will read a FASTA file which is usually in this format:
>gi|253795547|ref|NC_012960.1| Candidatus Hodgkinia cicadicola Dsem chromosome, 52 lines
GACGGCTTGTTTGCGTGCGACGAGTTTAGGATTGCTCTTTTGCTAAGCTTGGGGGTTGCGCCCAAAGTGA
TTAGATTTTCCGACAGCGTACGGCGCGCGCTGCTGAACGTGGCCACTGAGCTTACACCTCATTTCAGCGC
TCGCTTGCTGGCGAAGCTGGCAGCAGCTTGTTAATGCTAGTGTTGGGCTCGCCGAAAGCTGGCAGGTCGA
I've created another program that reads the first line(aka header) of this FASTA file and now I want this second program to start reading and printing beginning from the sequence.
How would I do that?
so far i have this:
FASTA = open("test.txt", "r")
def readSeq(FASTA):
"""returns the DNA sequence of a FASTA file"""
for line in FASTA:
line = line.strip()
print line
readSeq(FASTA)
Thanks guys
-Noob
Upvotes: 5
Views: 13708
Reputation: 1233
A pythonic and simple way to do this would be slice notation.
>>> f = open('filename')
>>> lines = f.readlines()
>>> lines[1:]
['TTAGATTTTCCGACAGCGTACGGCGCGCGCTGCTGAACGTGGCCACTGAGCTTACACCTCATTTCAGCGC\n', 'TCGCTTGCTGGCGAAGCTGGCAGCAGCTTGTTAATGCTAGTG
TTGGGCTCGCCGAAAGCTGGCAGGTCGA']
That says "give me all elements of lines, from the second (index 1) to the end.
Other general uses of slice notation:
s[i:j] slice of s from i to j
s[i:j:k] slice of s from i to j with step k (k can be negative to go backward)
Either i or j can be omitted (to imply the beginning or the end), and j can be negative to indicate a number of elements from the end.
s[:-1] All but the last element.
Edit in response to gnibbler's comment:
If the file is truly massive you can use iterator slicing to get the same effect while making sure you don't get the whole thing in memory.
import itertools
f = open("filename")
#start at the second line, don't stop, stride by one
for line in itertools.islice(f, 1, None, 1):
print line
"islicing" doesn't have the nice syntax or extra features of regular slicing, but it's a nice approach to remember.
Upvotes: 1
Reputation: 178
good to see another bioinformatician :)
just include an if clause within your for loop above the line.strip() call
def readSeq(FASTA):
for line in FASTA:
if line.startswith('>'):
continue
line = line.strip()
print(line)
Upvotes: 1
Reputation: 83032
def readSeq(FASTA):
"""returns the DNA sequence of a FASTA file"""
_unused = FASTA.next() # skip heading record
for line in FASTA:
line = line.strip()
print line
Read the docs on file.next() to see why you should be wary of mixing file.readline()
with for line in file:
Upvotes: 5
Reputation: 39297
You might be interested in checking BioPythons
handling of Fasta files (source
).
def FastaIterator(handle, alphabet = single_letter_alphabet, title2ids = None):
"""Generator function to iterate over Fasta records (as SeqRecord objects).
handle - input file
alphabet - optional alphabet
title2ids - A function that, when given the title of the FASTA
file (without the beginning >), will return the id, name and
description (in that order) for the record as a tuple of strings.
If this is not given, then the entire title line will be used
as the description, and the first word as the id and name.
Note that use of title2ids matches that of Bio.Fasta.SequenceParser
but the defaults are slightly different.
"""
#Skip any text before the first record (e.g. blank lines, comments)
while True:
line = handle.readline()
if line == "" : return #Premature end of file, or just empty?
if line[0] == ">":
break
while True:
if line[0]!=">":
raise ValueError("Records in Fasta files should start with '>' character")
if title2ids:
id, name, descr = title2ids(line[1:].rstrip())
else:
descr = line[1:].rstrip()
id = descr.split()[0]
name = id
lines = []
line = handle.readline()
while True:
if not line : break
if line[0] == ">": break
#Remove trailing whitespace, and any internal spaces
#(and any embedded \r which are possible in mangled files
#when not opened in universal read lines mode)
lines.append(line.rstrip().replace(" ","").replace("\r",""))
line = handle.readline()
#Return the record and then continue...
yield SeqRecord(Seq("".join(lines), alphabet),
id = id, name = name, description = descr)
if not line : return #StopIteration
assert False, "Should not reach this line"
Upvotes: 2
Reputation: 25609
you should show your script. To read from second line, something like this
f=open("file")
f.readline()
for line in f:
print line
f.close()
Upvotes: 4